Understanding Read Formats and Quality Controlling Data¶
author: | Chris Welcher and C. Titus Brown |
---|
Note: there are generic instructions for doing quality control at the khmer-protocols Web site. These should work for most Illumina data sets, even those consisting of multiple files. Below, we’ve done a bit of a shorthand because we only have a small data set to filter.
The fastq Format¶
After spending weeks, nay, months of time on designing your study and planning your bioinformatics goals (right?), you finally get the email from you sequencing center: they have your data! You get a link to an ftp server and some login information, and are presented with a list of files. But what are these formats?
Most commonly, you’ll get your data in fastq format. fastq is a really simple way of representing sequence in plain text which is understood by pretty much every piece of bioinformatics software. A fastq file can contain anywhere from one to billions of sequences, and is usually used for reads before they have been assembled. A faux example of the format is:
@read1
+
ATCGTAGCTAGCTAGCT
+
DH<F4CFDFH@FHIBBE
The first line is the name of the sequence; there is no set format for this, though most of the big centers like the NCBI have set standards. This is followed by a ‘+’, a line break, and then the sequence itself, which can be either nucleotide or protein. Then we have another line break, a ‘+’, and a line break, followed by the quality line.
The quality line is the part of the format which is not immediately obvious. This line follows what is known as the phred format. Each ASCII character corresponds to a base, and its integer mapping is used in the equation \(P = 10^{-Q / 10}\), where \(Q\) is the phred score and \(P\) is the probability that the base is incorrectly called.
The counterpart to fastq is fasta, which is essentially fastq without the quality score and a minor formatting change:
>read1
ATCGTAGGTAGGATATA
fasta is usually output by assembly programs, and can be used if data has already been quality controlled and needs to be a more manageable size. However, if you’re not sure what preprocessing steps your data has been through, but you have fasta instead of fastq, you’d be well-off to make sure of what those steps were.
Getting the Data¶
Now that you know a little about the format, let’s look at some data.
Copy the data in ‘mrnaseq-demo’ (under TrainingFiles, NGS bootcamp biologists) into your home directory on your machine. Be sure to copy and paste the entire folder!
Now, let’s look at it:
cd ~/mrnaseq-demo
ls
The data came from this study, if you’re interested.
To take a quick look at the files, use less:
less 0Hour_ATCACG_L002_R1_001.pe.qc.fq.gz
Hit ‘q’ to quit less.
These reads are compressed with gzip to save some space. In the .pe files, they are interleaved paired FASTQ – you can see the /1 and /2 – output by the quality trimming step; and orphaned reads, in .se.
For example, in an interleaved file, you have:
@SRR390202.1 M10_0139:1:2:18915:1321/1
ATCAAGAAAGATTTTAACAGCATTGAC
+
ECCFFFDDHGHFDHJJJJIGIDIJJJJ
@SRR390202.1 M10_0139:1:2:18915:1321/2
GTTCATAGTGACAAGGTAATATTTGTC
+
FDFFFFHHGGIJIF?CIGJJGI@FEFH
Naturally, because this is a standard, almost every program has a different way of doing it. So, be sure to double check the pairing format in your data!
Assessing your Data with FastQC¶
Before you go wildly charging at your data with trimmers and filters, it’s always a good idea to know what your data looks like ahead of time. The program we will use for this is FastQC, which parses the quality information from all the reads and produces handy charts and statistics:
mkdir ~/fastqc
chmod +x ~/software/FastQC/FastQC/fastqc
~/software/FastQC/FastQC/fastqc 0Hour_ATCACG_L002_R1_001.* -o ~/fastqc
There is a folder for each of your sequence files, each of which
contains a file called fastqc_report.html
. Clicking on that file
will render the report in your browser.
Note, these data have already been processed with the trimming and filtering steps here: